Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3359839
End position: 3359874
Length: 36

DNA sequence
>NC_015671, from 3359839 to 3359874 (36 bp); Cellvibrio gilvus ATCC 13127 CGCGACCGTGAGCCCGACCGCGAGCGCGACCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3358934-3362008	Sequence	Celgi_3051 - NADH/Ubiquinone/plastoquinone (complex I) (Protein is coded in complementary strand; from 3362008 to 3358934)