Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3525370
End position: 3525405
Length: 36

DNA sequence
>NC_015671, from 3525370 to 3525405 (36 bp); Cellvibrio gilvus ATCC 13127 AGCCGGGCGACGAACCGGCCGACGCGCCGCGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3525115-3525411	Sequence	Celgi_3207 - hypothetical protein (Protein is coded in complementary strand; from 3525411 to 3525115)