Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 35301
End position: 35336
Length: 36

DNA sequence
>NC_015671, from 35301 to 35336 (36 bp); Cellvibrio gilvus ATCC 13127 GGGGTGGGAGTGGGCGTGGGCGTGGGGCTGGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 35247-36644	Sequence	Celgi_0032 - Ser/Thr phosphatase (Protein is coded in complementary strand; from 36644 to 35247)