Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 41373
End position: 41408
Length: 36

DNA sequence
>NC_015671, from 41373 to 41408 (36 bp); Cellvibrio gilvus ATCC 13127 CGCGCCCACCCTCGCGCCCGCGCTCGCGCCCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 40169-41470	Sequence	Celgi_0037 - phosphate ABC transporter, inner membrane subunit PstA