Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 729573
End position: 729608
Length: 36

DNA sequence
>NC_015671, from 729573 to 729608 (36 bp); Cellvibrio gilvus ATCC 13127 CGACCACCACCGCGAGCCCCACCGCGACCATCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 729266-729682	Sequence	Celgi_0666 - secretion protein HlyD family protein (Protein is coded in complementary strand; from 729682 to 729266)