Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1833704
End position: 1833743
Length: 40

DNA sequence
>NC_015671, from 1833704 to 1833743 (40 bp); Cellvibrio gilvus ATCC 13127 CGTCAGGTCACGTCAGGCCAGATCAGGTCACGTCAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1833732-1834958	Sequence	Celgi_1687 - hypothetical protein (Protein is coded in complementary strand; from 1834958 to 1833732)