Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1576900
End position: 1576944
Length: 45

DNA sequence
>NC_015671, from 1576900 to 1576944 (45 bp); Cellvibrio gilvus ATCC 13127 GCCGCGGCCAAGAAGGCACCCGCCAAGAAGGCCCCGGCCAAGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1576517-1578142	Sequence	Celgi_1444 - RNA polymerase, sigma 70 subunit, RpoD subfamily