Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1985068
End position: 1985112
Length: 45

DNA sequence
>NC_015671, from 1985068 to 1985112 (45 bp); Cellvibrio gilvus ATCC 13127 ACGACCGCGAGCGGCAGGACCACGAGCGCCGCGACCGCGAGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1983748-1985649	Sequence	Celgi_1830 - ABC transporter related protein (Protein is coded in complementary strand; from 1985649 to 1983748)