Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2009454
End position: 2009498
Length: 45

DNA sequence
>NC_015671, from 2009454 to 2009498 (45 bp); Cellvibrio gilvus ATCC 13127 CTCGTCGTCGTCGGCCTCGTCGGCCTCGTCCTCGTCGGCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2009344-2009727	Sequence	Celgi_1851 - hypothetical protein (Protein is coded in complementary strand; from 2009727 to 2009344)