Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2045955
End position: 2045999
Length: 45

DNA sequence
>NC_015671, from 2045955 to 2045999 (45 bp); Cellvibrio gilvus ATCC 13127 CGGACACCGGAGCCTCGGACACCGAAGGCTCCGGCACCGGAGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2045222-2046283	Sequence	Celgi_1882 - hypothetical protein (Protein is coded in complementary strand; from 2046283 to 2045222)