Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2277210
End position: 2277254
Length: 45

DNA sequence
>NC_015671, from 2277210 to 2277254 (45 bp); Cellvibrio gilvus ATCC 13127 GGCCGGAGCCGCGGGTGCGGCAGCCGCGGGTGCCGGGGCGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2274610-2277486	Sequence	Celgi_2079 - translation initiation factor IF-2 (Protein is coded in complementary strand; from 2277486 to 2274610)