Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2294921
End position: 2294965
Length: 45

DNA sequence
>NC_015671, from 2294921 to 2294965 (45 bp); Cellvibrio gilvus ATCC 13127 CGGCGGGCGCCTCCTCGGCGGCCGGCGCCTCGGCCGGGGCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2294872-2295771	Sequence	Celgi_2098 - 30S ribosomal protein S2 (Protein is coded in complementary strand; from 2295771 to 2294872)