Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2473788
End position: 2473832
Length: 45

DNA sequence
>NC_015671, from 2473788 to 2473832 (45 bp); Cellvibrio gilvus ATCC 13127 CTGCTGCGGGTAGCCCTGCTGCGGGTAGCCCTGCTGCGGGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2473351-2475435	Sequence	Celgi_2262 - hypothetical protein (Protein is coded in complementary strand; from 2475435 to 2473351)