Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2552977
End position: 2553021
Length: 45

DNA sequence
>NC_015671, from 2552977 to 2553021 (45 bp); Cellvibrio gilvus ATCC 13127 CGGCGGCACGCTCGGCCGCAGCACGGTCGGCGGCGGCACGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2551611-2553596	Sequence	Celgi_2326 - peptidase M15B and M15C DD-carboxypeptidase VanY/endolysin (Protein is coded in complementary strand; from 2553596 to 2551611)