Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2737735
End position: 2737779
Length: 45

DNA sequence
>NC_015671, from 2737735 to 2737779 (45 bp); Cellvibrio gilvus ATCC 13127 CTGCGGGTCGGGCGCCTGCTCGTCCGGCGCCTTCTCGTCGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2737646-2738458	Sequence	Celgi_2471 - Sua5/YciO/YrdC/YwlC family protein (Protein is coded in complementary strand; from 2738458 to 2737646)