Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2942502
End position: 2942546
Length: 45

DNA sequence
>NC_015671, from 2942502 to 2942546 (45 bp); Cellvibrio gilvus ATCC 13127 GGTGCAGCGGTGTCGGGTGCAGCGGTGTCGGGTGCAGCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2941077-2942867	Sequence	Celgi_2638 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 2942867 to 2941077)