Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2969552
End position: 2969596
Length: 45

DNA sequence
>NC_015671, from 2969552 to 2969596 (45 bp); Cellvibrio gilvus ATCC 13127 GACGTCCCGGTGTCCGACGAGCCCGTGTCCGACGAGCCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2969219-2969818	Sequence	Celgi_2664 - FMN-binding domain protein (Protein is coded in complementary strand; from 2969818 to 2969219)