Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3384718
End position: 3384762
Length: 45

DNA sequence
>NC_015671, from 3384718 to 3384762 (45 bp); Cellvibrio gilvus ATCC 13127 GCCGGCGCGGCAGGACCGGGCGCGGCGGGACCCGGCGCGGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3384445-3384771	Sequence	Celgi_3070 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 3384771 to 3384445)