Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 514981
End position: 515025
Length: 45

DNA sequence
>NC_015671, from 514981 to 515025 (45 bp); Cellvibrio gilvus ATCC 13127 GGCGCCAAGATCGGCGGCCCCAAGATCGGCGGCGCCAAGATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 514952-515470	Sequence	Celgi_0471 - flagellar basal body-associated protein FliL