Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 602811
End position: 602855
Length: 45

DNA sequence
>NC_015671, from 602811 to 602855 (45 bp); Cellvibrio gilvus ATCC 13127 CACGACGAACCCGCCCACGATCATCCCGCCGTCGACGATCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 602339-602893	Sequence	Celgi_0562 - large conductance mechanosensitive channel protein