Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 871490
End position: 871537
Length: 48

DNA sequence
>NC_015671, from 871490 to 871537 (48 bp); Cellvibrio gilvus ATCC 13127 CCCGCTGAACGCCCCGCCGGACGCCCCGCTGAACGCCCCGCCGGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 871245-873014	Sequence	Celgi_0791 - hypothetical protein (Protein is coded in complementary strand; from 873014 to 871245)