Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3474319
End position: 3474369
Length: 51

DNA sequence
>NC_015671, from 3474319 to 3474369 (51 bp); Cellvibrio gilvus ATCC 13127 GGGCCGGACCACCAGCAGGGCCGCGTCACCAGCAGGGCCGGCTCACCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3474362-3474859	Sequence	Celgi_3159 - hypothetical protein (Protein is coded in complementary strand; from 3474859 to 3474362)