Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1903246
End position: 1903297
Length: 52

DNA sequence
>NC_015671, from 1903246 to 1903297 (52 bp); Cellvibrio gilvus ATCC 13127 GGCGGGTCAGTCGGGCGGGTCAGTCGGGCGGATCGGTCGGGCGGGTCAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1903292-1903711	Sequence	Celgi_1761 - hypothetical protein (Protein is coded in complementary strand; from 1903711 to 1903292)