Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2888646
End position: 2888705
Length: 60

DNA sequence
>NC_015671, from 2888646 to 2888705 (60 bp); Cellvibrio gilvus ATCC 13127 CGTGCTCGTGCTCGTCGTGCTCGTGCTCGTCGTGCTCGTGCTCGTCGTGCTCGTGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2886937-2889129	Sequence	Celgi_2591 - secretion protein HlyD family protein (Protein is coded in complementary strand; from 2889129 to 2886937)