Sequence retrieval

Genome: Pyrococcus yayanosii CH1
Start position: 1217883
End position: 1217906
Length: 24

DNA sequence
>NC_015680, from 1217883 to 1217906 (24 bp); Pyrococcus yayanosii CH1 AGAGGCAGAGAGGCAAAGAGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1217298-1218179	Sequence	PYCH_13870 - evolution of Prochlorococcus (Protein is coded in complementary strand; from 1218179 to 1217298)