Sequence retrieval

Genome: Pyrococcus yayanosii CH1
Start position: 66960
End position: 66983
Length: 24

DNA sequence
>NC_015680, from 66960 to 66983 (24 bp); Pyrococcus yayanosii CH1 TGAGCTTGAGCTTGACCTTGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 66608-67942	Sequence	PYCH_00690 - amidophosphoribosyltransferase (Protein is coded in complementary strand; from 67942 to 66608)