Sequence retrieval

Genome: Pyrococcus yayanosii CH1
Start position: 1093282
End position: 1093317
Length: 36

DNA sequence
>NC_015680, from 1093282 to 1093317 (36 bp); Pyrococcus yayanosii CH1 TTCCTGAACAACTTCCTGAACTTCTTCCTCAGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1092632-1093852	Sequence	PYCH_12380 - flagella-like protein D or E (Protein is coded in complementary strand; from 1093852 to 1092632)