Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1184860
End position: 1184883
Length: 24

DNA sequence
>NC_015687, from 1184860 to 1184883 (24 bp); Clostridium acetobutylicum DSM 1731 TTCTTCTTCTACTTCTTCTTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1184855-1185049	Sequence	SMB_G1052 - hypothetical protein (Protein is coded in complementary strand; from 1185049 to 1184855)