Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1813491
End position: 1813514
Length: 24

DNA sequence
>NC_015687, from 1813491 to 1813514 (24 bp); Clostridium acetobutylicum DSM 1731 TATTATTACTATCATTATTATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1813420-1815198	Sequence	SMB_G1694 cstA carbon starvation protein (Protein is coded in complementary strand; from 1815198 to 1813420)