Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2736958
End position: 2736981
Length: 24

DNA sequence
>NC_015687, from 2736958 to 2736981 (24 bp); Clostridium acetobutylicum DSM 1731 TTCTTTTTCTTCTTATTTTTCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2736234-2737046	Sequence	SMB_G2660 - hypothetical protein (Protein is coded in complementary strand; from 2737046 to 2736234)