Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3940707
End position: 3940730
Length: 24

DNA sequence
>NC_015687, from 3940707 to 3940730 (24 bp); Clostridium acetobutylicum DSM 1731 TAACTTTAATTTCAACTTTATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3940178-3940807	Sequence	SMB_G3778 jag RNA-binding protein Jag, SpoIIIJ-associated (Protein is coded in complementary strand; from 3940807 to 3940178)