Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3940846
End position: 3940869
Length: 24

DNA sequence
>NC_015687, from 3940846 to 3940869 (24 bp); Clostridium acetobutylicum DSM 1731 TTTTTCTTGTTCTTTTTATTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3940843-3941607	Sequence	SMB_G3779 oxaA inner membrane protein translocase component YidC (Protein is coded in complementary strand; from 3941607 to 3940843)