Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1189233
End position: 1189257
Length: 25

DNA sequence
>NC_015687, from 1189233 to 1189257 (25 bp); Clostridium acetobutylicum DSM 1731 AAATCAAACCAAATACAATCAAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1188950-1189669	Sequence	SMB_G1057 yjbE membrane protein, TerC-like protein (Protein is coded in complementary strand; from 1189669 to 1188950)