Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1477161
End position: 1477187
Length: 27

DNA sequence
>NC_015687, from 1477161 to 1477187 (27 bp); Clostridium acetobutylicum DSM 1731 TAATTCGTGTAAATCGTGTAATTCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1476634-1477203	Sequence	SMB_G1358 - spore coat protein F (cotf)-like protein (Protein is coded in complementary strand; from 1477203 to 1476634)