Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2214896
End position: 2214922
Length: 27

DNA sequence
>NC_015687, from 2214896 to 2214922 (27 bp); Clostridium acetobutylicum DSM 1731 TCATTTATATTATTTATATCATTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2214338-2215078	Sequence	SMB_G2155 ylxW hypothetical protein (Protein is coded in complementary strand; from 2215078 to 2214338)