Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3284838
End position: 3284864
Length: 27

DNA sequence
>NC_015687, from 3284838 to 3284864 (27 bp); Clostridium acetobutylicum DSM 1731 CAGCTGCTGCACCTGCTGCACCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3284618-3284989	Sequence	SMB_G3180 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 3284989 to 3284618)