Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2299435
End position: 2299464
Length: 30

DNA sequence
>NC_015687, from 2299435 to 2299464 (30 bp); Clostridium acetobutylicum DSM 1731 TATATTTCTTTATTTTTTTTTATATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2299455-2299799	Sequence	SMB_G2237 - hypothetical protein (Protein is coded in complementary strand; from 2299799 to 2299455)