Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2558785
End position: 2558814
Length: 30

DNA sequence
>NC_015687, from 2558785 to 2558814 (30 bp); Clostridium acetobutylicum DSM 1731 ATAGCAATAAATAAAAATAAATAGAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2558551-2559351	Sequence	SMB_G2475 - hypothetical protein (Protein is coded in complementary strand; from 2559351 to 2558551)