Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3183235
End position: 3183264
Length: 30

DNA sequence
>NC_015687, from 3183235 to 3183264 (30 bp); Clostridium acetobutylicum DSM 1731 GCTTTTGAAATCCTTTGAAAACTTTTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3181007-3185062	Sequence	SMB_G3072 - superfamily I DNA helicase (Protein is coded in complementary strand; from 3185062 to 3181007)