Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2309872
End position: 2309904
Length: 33

DNA sequence
>NC_015687, from 2309872 to 2309904 (33 bp); Clostridium acetobutylicum DSM 1731 TTCATTATCAATTCATTATCAATTCTTTATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2309891-2310289	Sequence	SMB_G2250 - chemotaxis signal transduction protein CheW (Protein is coded in complementary strand; from 2310289 to 2309891)