Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3365932
End position: 3365966
Length: 35

DNA sequence
>NC_015687, from 3365932 to 3365966 (35 bp); Clostridium acetobutylicum DSM 1731 CTTTTTTATTTTTTCTTTTCTCTTTCTTCTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3363891-3367406	Sequence	SMB_G3253 mfd transcription-repair coupling factor (Protein is coded in complementary strand; from 3367406 to 3363891)