Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1499707
End position: 1499742
Length: 36

DNA sequence
>NC_015687, from 1499707 to 1499742 (36 bp); Clostridium acetobutylicum DSM 1731 TCATCTAAATCATCTAAATCATCTAAATCATCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1499413-1500879	Sequence	SMB_G1376 nagE phosphotransferase system IIC component (Protein is coded in complementary strand; from 1500879 to 1499413)