Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2216871
End position: 2216906
Length: 36

DNA sequence
>NC_015687, from 2216871 to 2216906 (36 bp); Clostridium acetobutylicum DSM 1731 TTGTTATTCTTTTTCTTCTTCTTTTTTTTCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2216186-2216935	Sequence	SMB_G2158 - cell division protein FtsQ (Protein is coded in complementary strand; from 2216935 to 2216186)