Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3123924
End position: 3123959
Length: 36

DNA sequence
>NC_015687, from 3123924 to 3123959 (36 bp); Clostridium acetobutylicum DSM 1731 CTTCTGCTTTTACTTCTGCTTTTACTTCTGCTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3123281-3124756	Sequence	SMB_G3021 - hypothetical protein (Protein is coded in complementary strand; from 3124756 to 3123281)