Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 1280344
End position: 1280388
Length: 45

DNA sequence
>NC_015687, from 1280344 to 1280388 (45 bp); Clostridium acetobutylicum DSM 1731 GTTATACTATTTGCTTGAATACTATTTGCTTGAATACTATTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1277464-1280721	Sequence	SMB_G1132 - hypothetical protein (Protein is coded in complementary strand; from 1280721 to 1277464)