Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 3475130
End position: 3475174
Length: 45

DNA sequence
>NC_015687, from 3475130 to 3475174 (45 bp); Clostridium acetobutylicum DSM 1731 GTAACCTTCTTTTTCAAAGCCTTCTTTTTCAAAGCCTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3474975-3475874	Sequence	SMB_G3342 - hypothetical protein (Protein is coded in complementary strand; from 3475874 to 3474975)