Sequence retrieval

Genome: Clostridium acetobutylicum DSM 1731
Start position: 2642968
End position: 2643027
Length: 60

DNA sequence
>NC_015687, from 2642968 to 2643027 (60 bp); Clostridium acetobutylicum DSM 1731 TGTTGTTGTTCCTGTTGGTGTTATTACTGTCGTTGTTGTTCCTGCTGTCGTTGTTCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2642894-2644054	Sequence	SMB_G2568 - ChW repeat-containing protein (Protein is coded in complementary strand; from 2644054 to 2642894)