Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 2637972
End position: 2637995
Length: 24

DNA sequence
>NC_015731, from 2637972 to 2637995 (24 bp); Nitrosomonas sp. Is79A3 GGAGGTGGTGGTGGTGGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2634549-2644187	Sequence	Nit79A3_2482 - hypothetical protein (Protein is coded in complementary strand; from 2644187 to 2634549)