Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 2827094
End position: 2827117
Length: 24

DNA sequence
>NC_015731, from 2827094 to 2827117 (24 bp); Nitrosomonas sp. Is79A3 AATCAGCATCAGAATCAGAATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2826984-2827142	Sequence	Nit79A3_2645 - hypothetical protein (Protein is coded in complementary strand; from 2827142 to 2826984)