Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 294752
End position: 294775
Length: 24

DNA sequence
>NC_015731, from 294752 to 294775 (24 bp); Nitrosomonas sp. Is79A3 TCTCCATCTTCATCTTCATCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 293504-295744	Sequence	Nit79A3_0256 - RNA polymerase, sigma 70 subunit, RpoD (Protein is coded in complementary strand; from 295744 to 293504)